Stem-loop sequence mle-mir-12098

AccessionMI0039606 (change log)
DescriptionMelibe leonina miR-12098 stem-loop
Stem-loop
   --u   a    cu           --uu     
5'    cgg uuug  ggucggacaua    cugu 
      ||| ||||  |||||||||||    ||| g
3'    gcc aaac  cuagccugugu    ggca 
   ugc   c    au           uuau     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-12098-5p

Accession MIMAT0048835
Sequence

1 - 

ucggauuugcuggucggacaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-12098-3p

Accession MIMAT0048836
Sequence

40 - 

uguccgaucuacaaacccgcgu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).