Stem-loop sequence mle-mir-12097

AccessionMI0039605 (change log)
DescriptionMelibe leonina miR-12097 stem-loop
Stem-loop
   --    a    cu   u       -ug  c 
5'   uggg cuuc  ggg cauugca   uc g
     |||| ||||  ||| |||||||   || a
3'   accc gaag  ccc guaaugu   ag u
   gg    -    uc   c       uaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-12097-5p

Accession MIMAT0048833
Sequence

1 - 

ugggacuuccugggucauugca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-12097-3p

Accession MIMAT0048834
Sequence

39 - 

uaaugcccccugaagcccagg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).