Stem-loop sequence mle-mir-12096b

AccessionMI0039604 (change log)
DescriptionMelibe leonina miR-12096b stem-loop
Stem-loop
   --aag       u        uc   auga 
5'      cgguggu guuuuguu  acu    a
        ||||||| ||||||||  |||     
3'      gccacua uaaaacgg  uga    c
   gauua       u        ga   aagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-12096b-5p

Accession MIMAT0048831
Sequence

1 - 

aagcggugguuguuuuguuucacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-12096b-3p

Accession MIMAT0048832
Sequence

37 - 

uagggcaaaauuaucaccgauuag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).