![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mle-mir-12096a |
|
Accession | MI0039603 (change log) |
Description | Melibe leonina miR-12096a stem-loop |
Stem-loop |
--ag gu g aucauc 5' cggugaua uuugucu gc a |||||||| ||||||| || 3' gccacuau aaacggg ug c auua ug a aaaaca |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence mle-miR-12096a-5p |
|
Accession | MIMAT0048829 |
Sequence |
1 - agcggugauaguuuugucuggca - 23 |
Evidence | experimental; Illumina [1] |
Mature sequence mle-miR-12096a-3p |
|
Accession | MIMAT0048830 |
Sequence |
38 - uagggcaaaguuaucaccgauua - 60 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:26473382
"A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome"
Annu Rev Genet. 49:213-242(2015).
|