Stem-loop sequence mle-mir-12096a

AccessionMI0039603 (change log)
DescriptionMelibe leonina miR-12096a stem-loop
Stem-loop
   --ag        gu       g  aucauc 
5'     cggugaua  uuugucu gc      a
       ||||||||  ||||||| ||       
3'     gccacuau  aaacggg ug      c
   auua        ug       a  aaaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-12096a-5p

Accession MIMAT0048829
Sequence

1 - 

agcggugauaguuuugucuggca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-12096a-3p

Accession MIMAT0048830
Sequence

38 - 

uagggcaaaguuaucaccgauua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).