Stem-loop sequence mle-mir-2722

AccessionMI0039602 (change log)
DescriptionMelibe leonina miR-2722 stem-loop
Stem-loop
   --g        -   a        a  gu 
5'    agguguuu cau ggugcuac gu  u
      |||||||| ||| |||||||| ||  u
3'    ucuacaaa gug ccgcggug ca  g
   ccg        a   -        -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-2722-5p

Accession MIMAT0048827
Sequence

1 - 

gagguguuucauaggugcuaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-2722-3p

Accession MIMAT0048828
Sequence

35 - 

uggcgccgugaaaacaucugcc

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).