Stem-loop sequence mle-mir-2001

AccessionMI0039601 (change log)
DescriptionMelibe leonina miR-2001 stem-loop
Stem-loop
   --      c  u   ac          uc  c 
5'   uuguga cg uca  ugggcauugg  ac u
     |||||| || |||  ||||||||||  ||  
3'   aauacu gc agu  gcucguaacu  ug c
   gu      u  u   -c          gc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-2001-5p

Accession MIMAT0048825
Sequence

1 - 

uugugaccguucaacugggcauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-2001-3p

Accession MIMAT0048826
Sequence

42 - 

ugcucgcugaucguucauaaug

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).