Stem-loop sequence mle-mir-1994b

AccessionMI0039600 (change log)
DescriptionMelibe leonina miR-1994b stem-loop
Stem-loop
   --    ga   aau      a    u  auuc 
5'   aggg  gac   cugucu caug gc    a
     ||||  |||   |||||| |||| ||     
3'   uccc  cug   gacaga guac ug    u
   ac    uc   cgu      -    -  accu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-1994b-5p

Accession MIMAT0048823
Sequence

1 - 

aggggagacaaucugucuacaug

 - 23

Get sequence
Evidence not experimental

Mature sequence mle-miR-1994b-3p

Accession MIMAT0048824
Sequence

41 - 

ugagacagugcguccucccuca

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).