Stem-loop sequence mle-mir-1990

AccessionMI0039595 (change log)
DescriptionMelibe leonina miR-1990 stem-loop
Stem-loop
   --    a     u gg     a  uu  gug 
5'   agua guuga g  guccc gg  gu   u
     |||| ||||| |  ||||| ||  ||    
3'   ucau caacu c  caggg cc  ua   c
   gu    -     u au     c  uc  agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-1990-5p

Accession MIMAT0048813
Sequence

1 - 

aguaaguugauggggucccagg

 - 22

Get sequence
Evidence not experimental

Mature sequence mle-miR-1990-3p

Accession MIMAT0048814
Sequence

41 - 

cgggacuacuucaacuacuug

 - 61

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).