Stem-loop sequence mle-mir-1989b

AccessionMI0039594 (change log)
DescriptionMelibe leonina miR-1989b stem-loop
Stem-loop
   --u       cau           ga   g 
5'    cagcugu   gaugccuucuu  ugu a
      |||||||   |||||||||||  ||| c
3'    gucggca   uuacggaagaa  aca c
   acu       uuu           --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-1989b-5p

Accession MIMAT0048811
Sequence

1 - 

ucagcugucaugaugccuucuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-1989b-3p

Accession MIMAT0048812
Sequence

38 - 

gaaggcauuuuuacggcuguca

 - 59

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).