Stem-loop sequence mle-mir-1989a

AccessionMI0039593 (change log)
DescriptionMelibe leonina miR-1989a stem-loop
Stem-loop
   --      g         c        a 
5'   ucagcu uuucgaugc uucuugua g
     |||||| ||||||||| |||||||| c
3'   agucga aagguuacg aagaaugu u
   ca      a         a        g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-1989a-5p

Accession MIMAT0048809
Sequence

1 - 

ucagcuguuucgaugccuucuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-1989a-3p

Accession MIMAT0048810
Sequence

36 - 

gaaagcauuggaaaagcugaac

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).