Stem-loop sequence mle-mir-1986

AccessionMI0039590 (change log)
DescriptionMelibe leonina miR-1986 stem-loop
Stem-loop
   --      cg       ca    -      
5'   cgcggg  uugggga  ccac guacg 
     ||||||  |||||||  |||| |||| a
3'   gugccu  aacccuu  ggug uaugu 
   ua      ag       ua    g      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-1986-5p

Accession MIMAT0048803
Sequence

1 - 

cgcgggcguuggggacaccacg

 - 22

Get sequence
Evidence not experimental

Mature sequence mle-miR-1986-3p

Accession MIMAT0048804
Sequence

35 - 

uggauuucccaagauccgugau

 - 56

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).