Stem-loop sequence mle-mir-1985

AccessionMI0039589 (change log)
DescriptionMelibe leonina miR-1985 stem-loop
Stem-loop
   --u      u  uu     a     u uua 
5'    gccauu uu  caguc cugug g   u
      |||||| ||  ||||| ||||| |   u
3'    ugguaa aa  gucag ggcac c   g
   guu      c  cu     g     - uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-1985-5p

Accession MIMAT0048801
Sequence

1 - 

ugccauuuuuuucagucacugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-1985-3p

Accession MIMAT0048802
Sequence

39 - 

ggggacugucaacaaugguuug

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).