Stem-loop sequence mle-mir-365

AccessionMI0039584 (change log)
DescriptionMelibe leonina miR-365 stem-loop
Stem-loop
   --a     a     a     ca   cuaca 
5'    ggguu ucgag ggcau  aug     g
      ||||| ||||| |||||  |||      
3'    cccaa aguuc ccgua  uac     u
   aca     a     c     -a   cacac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-365-5p

Accession MIMAT0048791
Sequence

1 - 

aggguuaucgagaggcaucaaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-365-3p

Accession MIMAT0048792
Sequence

38 - 

uaaugccccuugaaaacccaca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).