Stem-loop sequence mle-mir-277

AccessionMI0039579 (change log)
DescriptionMelibe leonina miR-277 stem-loop
Stem-loop
   ---a        -        c    --    cc 
5'     gugccagg agugcauu uaca  gugu  a
       |||||||| |||||||| ||||  ||||   
3'     uauggucu uuacguaa augu  caua  u
   aguc        a        -    gc    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-277-5p

Accession MIMAT0048781
Sequence

1 - 

agugccaggagugcauucuaca

 - 22

Get sequence
Evidence not experimental

Mature sequence mle-miR-277-3p

Accession MIMAT0048782
Sequence

41 - 

uaaaugcauuaucugguaucuga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).