Stem-loop sequence mle-mir-219

AccessionMI0039575 (change log)
DescriptionMelibe leonina miR-219 stem-loop
Stem-loop
   --    u     aa    a      -   c 
5'   ugau gucca  cgca uucuug uua a
     |||| |||||  |||| |||||| ||| u
3'   acua caggu  gugu aagaac aau c
   ug    -     gg    c      c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-219-5p

Accession MIMAT0048773
Sequence

1 - 

ugauuguccaaacgcaauucuug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-219-3p

Accession MIMAT0048774
Sequence

38 - 

agaacuguggguggacaucagu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).