Stem-loop sequence mle-mir-216b

AccessionMI0039574 (change log)
DescriptionMelibe leonina miR-216b stem-loop
Stem-loop
   --u             aa       uugug 
5'    aauaucagcuggu  uccugag     g
      |||||||||||||  |||||||      
3'    uuaugguugauca  aggacuc     u
   acu             -g       ugagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-216b-5p

Accession MIMAT0048771
Sequence

1 - 

uaauaucagcugguaauccugag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-216b-3p

Accession MIMAT0048772
Sequence

38 - 

caggagacuaguugguauuuca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).