Stem-loop sequence mle-mir-216a

AccessionMI0039573 (change log)
DescriptionMelibe leonina miR-216a stem-loop
Stem-loop
   --       a          c    u  acc 
5'   uaaucuc gcugguaauu ugag gu   u
     ||||||| |||||||||| |||| ||    
3'   auuggag cgaccauuga acuc ca   g
   ac       c          -    -  acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-216a-5p

Accession MIMAT0048769
Sequence

1 - 

uaaucucagcugguaauucugag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-216a-3p

Accession MIMAT0048770
Sequence

39 - 

caaguuaccagccgagguuaca

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).