Stem-loop sequence mle-mir-190

AccessionMI0039570 (change log)
DescriptionMelibe leonina miR-190 stem-loop
Stem-loop
   --a        u     au      uu  a 
5'    gauauguu gauau  uuggug  gu a
      |||||||| |||||  ||||||  || c
3'    cuauacag cugua  agccac  cg a
   aga        u     --      -u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-190-5p

Accession MIMAT0048763
Sequence

1 - 

agauauguuugauauauuuggug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-190-3p

Accession MIMAT0048764
Sequence

38 - 

ccgaaugucugacauaucaga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).