Stem-loop sequence mle-mir-263a

AccessionMI0039568 (change log)
DescriptionMelibe leonina miR-263a stem-loop
Stem-loop
   --a   g      u    uu     -u  gcu 
5'    aug cacugg agaa  cacgg  uu   u
      ||| |||||| ||||  |||||  ||    
3'    uac guggcc ucuu  gugcc  aa   u
   auc   g      u    --     uc  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-263a-5p

Accession MIMAT0048759
Sequence

1 - 

aauggcacugguagaauucacgg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-263a-3p

Accession MIMAT0048760
Sequence

41 - 

guguucuuccgguggcaucua

 - 61

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).