Stem-loop sequence mle-mir-137

AccessionMI0039565 (change log)
DescriptionMelibe leonina miR-137 stem-loop
Stem-loop
   --   g       ug     a     --  a 
5'   acg guauucu  ggcaa uaaua  cg c
     ||| |||||||  ||||| |||||  || u
3'   ugc cauaaga  ucguu auugu  gc u
   aa   a       gu     -     cg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-137-5p

Accession MIMAT0048753
Sequence

1 - 

acggguauucuugggcaaauaau

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-137-3p

Accession MIMAT0048754
Sequence

39 - 

uauugcuugagaauacacguaa

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).