Stem-loop sequence mle-mir-96a

AccessionMI0039559 (change log)
DescriptionMelibe leonina miR-96a stem-loop
Stem-loop
   --c       ug c           a ga gu 
5'    uuggcac  g ggaauagucac g  a  g
      |||||||  | ||||||||||| |  |   
3'    aaccgug  c cuuuguuagug c  u  a
   aau       gu -           - ag ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-96a-5p

Accession MIMAT0048741
Sequence

1 - 

cuuggcacuggcggaauagucac

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-96a-3p

Accession MIMAT0048742
Sequence

41 - 

gauuguuuccuggugccaauaa

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).