Stem-loop sequence mle-mir-981

AccessionMI0039554 (change log)
DescriptionMelibe leonina miR-981 stem-loop
Stem-loop
   ---         -    cu    --     ccg 
5'    cggguuucg cgau  gcga  acagu   c
      ||||||||| ||||  ||||  |||||    
3'    guccaaagc gcug  ugcu  uguca   u
   ucc         u    -u    ug     aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-981-5p

Accession MIMAT0048731
Sequence

1 - 

cggguuucgcgaucugcgaaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-981-3p

Accession MIMAT0048732
Sequence

39 - 

uucguugucgucgaaaccugccu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).