Stem-loop sequence mle-mir-29b

AccessionMI0039548 (change log)
DescriptionMelibe leonina miR-29b stem-loop
Stem-loop
   --        c       ga     guccuu     u 
5'   cugauuuc aguggug  uagau      agggc c
     |||||||| |||||||  |||||      |||||  
3'   gacuaaag uuaccac  aucug      uucug g
   gu        u       -g     ------     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-29b-5p

Accession MIMAT0048720
Sequence

1 - 

cugauuuccagugguggauaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-29b-3p

Accession MIMAT0048721
Sequence

47 - 

uagcaccauuugaaaucagug

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).