Stem-loop sequence mle-mir-29a

AccessionMI0039547 (change log)
DescriptionMelibe leonina miR-29a stem-loop
Stem-loop
   --c     c  ucc      a     -uu a 
5'    cugau uc   uggugc uagau   g u
      ||||| ||   |||||| |||||   |  
3'    gacua ag   accacg aucug   c c
   uuu     a  uuu      -     cgu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-29a-5p

Accession MIMAT0048718
Sequence

1 - 

ccugaucucuccuggugcauaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-29a-3p

Accession MIMAT0048719
Sequence

39 - 

uagcaccauuugaaaucaguuu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).