Stem-loop sequence mle-mir-745a

AccessionMI0039545 (change log)
DescriptionMelibe leonina miR-745a stem-loop
Stem-loop
   ---          c u     a    --u    gg 
5'    cggcucuuca c gguag cuug   gagu  a
      |||||||||| | ||||| ||||   ||||   
3'    gucgagaagu g ccguc gaac   uucg  u
   ccu          a u     -    ugg    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-745a-5p

Accession MIMAT0048714
Sequence

1 - 

cggcucuucaccugguagacuug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-745a-3p

Accession MIMAT0048715
Sequence

44 - 

agcugccugaugaagagcugucc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).