Stem-loop sequence mle-mir-2k

AccessionMI0039538 (change log)
DescriptionMelibe leonina miR-2k stem-loop
Stem-loop
   --    u  cuu        c   -    c 
5'   gccc uc   cugguugu aug guga a
     |||| ||   |||||||| ||| ||||  
3'   cggg ag   gaccgaca uac cauu u
   au    u  uuu        c   u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-2k-5p

Accession MIMAT0048700
Sequence

1 - 

gcccuuccuucugguugucaug

 - 22

Get sequence
Evidence not experimental

Mature sequence mle-miR-2k-3p

Accession MIMAT0048701
Sequence

38 - 

ucacagccaguuugaugggcua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).