Stem-loop sequence mle-mir-2c

AccessionMI0039530 (change log)
DescriptionMelibe leonina miR-2c stem-loop
Stem-loop
   --a         -            ---   ac 
5'    cgucaaggc gguugugaugug   gug  u
      ||||||||| ||||||||||||   |||  g
3'    guaguuucg ccgacacuauac   cac  a
   aca         a            gaa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mle-miR-2c-5p

Accession MIMAT0048684
Sequence

1 - 

acgucaaggcgguugugaugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mle-miR-2c-3p

Accession MIMAT0048685
Sequence

41 - 

uaucacagccagcuuugaugaca

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).