Stem-loop sequence dno-mir-508

AccessionMI0039143 (change log)
DescriptionDasypus novemcinctus miR-508 stem-loop
Stem-loop
   --     c        u  u   cuaag 
5'   uacuc agagggug ca uca     a
     ||||| |||||||| || |||     u
3'   augag uuuuccac gu agu     a
   ag     u        u  u   acaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH564535.1: 697744-697800 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-508
dno-mir-509bJH564535.1: 690101-690158 [+]
dno-mir-508JH564535.1: 697744-697800 [+]
Database links

Mature sequence dno-miR-508-5p

Accession MIMAT0047954
Sequence

1 - 

uacuccagagggugucauucacu

 - 23

Get sequence
Evidence not experimental

Mature sequence dno-miR-508-3p

Accession MIMAT0047955
Sequence

35 - 

ugauugucaccuuuuugaguaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).