Stem-loop sequence dno-mir-219b

AccessionMI0039051 (change log)
DescriptionDasypus novemcinctus miR-219b stem-loop
Stem-loop
   --u   u     aa           ua  a  c 
5'    gau gucca  cgcaauucuug  ug gu u
      ||| |||||  |||||||||||  || || g
3'    cua caggu  guguuaagagc  ac cg c
   ugu   -     cg           ca  -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH564958.1: 47850-47914 [+]
intergenic
Database links

Mature sequence dno-miR-219b-5p

Accession MIMAT0047773
Sequence

1 - 

ugauuguccaaacgcaauucuug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-219b-3p

Accession MIMAT0047774
Sequence

44 - 

agaauuguggcuggacaucugu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).