Stem-loop sequence dno-mir-124-1

AccessionMI0038964 (change log)
DescriptionDasypus novemcinctus miR-124-1 stem-loop
Stem-loop
   --c        a   ga        uaau 
5'    guguucac gcg  ccuugauu    g
      |||||||| |||  ||||||||    u
3'    cguaagug cgc  ggaauuaa    c
   aac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH569073.1: 2335337-2335395 [+]
intergenic
Database links

Mature sequence dno-miR-124-5p

Accession MIMAT0047612
Sequence

1 - 

cguguucacagcggaccuugau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-124-3p

Accession MIMAT0047613
Sequence

38 - 

uaaggcacgcggugaaugccaa

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).