Stem-loop sequence dno-mir-30d

AccessionMI0038938 (change log)
DescriptionDasypus novemcinctus miR-30d stem-loop
Stem-loop
   --u         ccc           guaaag 
5'    guaaacauc   gacuggaagcu      a
      |||||||||   |||||||||||      u
3'    cguuuguag   cugacuuucga      a
   cgu         --a           aucaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH569858.1: 1749094-1749156 [-]
intergenic
Clustered miRNAs
< 10kb from dno-mir-30d
dno-mir-30dJH569858.1: 1749094-1749156 [-]
dno-mir-30bJH569858.1: 1744469-1744528 [-]
Database links

Mature sequence dno-miR-30d-5p

Accession MIMAT0047563
Sequence

1 - 

uguaaacauccccgacuggaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-30d-3p

Accession MIMAT0047564
Sequence

42 - 

cuuucagucagauguuugcugc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).