Stem-loop sequence dno-mir-23b

AccessionMI0038920 (change log)
DescriptionDasypus novemcinctus miR-23b stem-loop
Stem-loop
   --  --          -  c      gugacu 
5'   gg  guuccuggca ug ugauuu      u
     ||  |||||||||| || ||||||       
3'   cc  uagggaccgu ac acuaaa      a
   ca  au          u  -      auuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570415.1: 2090018-2090077 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-23b
dno-mir-23bJH570415.1: 2090018-2090077 [+]
dno-mir-27bJH570415.1: 2090250-2090312 [+]
dno-mir-24aJH570415.1: 2090841-2090900 [+]
Database links

Mature sequence dno-miR-23b-5p

Accession MIMAT0047530
Sequence

1 - 

ggguuccuggcaugcugauuu

 - 21

Get sequence
Evidence not experimental

Mature sequence dno-miR-23b-3p

Accession MIMAT0047531
Sequence

38 - 

aucacauugccagggauuaccac

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).