Stem-loop sequence dno-mir-23a

AccessionMI0038919 (change log)
DescriptionDasypus novemcinctus miR-23a stem-loop
Stem-loop
   --- gg        g    g      c  u 
5'    g  guuccugg gaug gauuug ug c
      |  |||||||| |||| |||||| || g
3'    c  uagggacc uuac cuaaac ac g
   aac uu        g    a      -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
AAGV03195862.1: 168-226 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-23a
dno-mir-23aAAGV03195862.1: 168-226 [+]
dno-mir-27aAAGV03195862.1: 315-376 [+]
dno-mir-24bAAGV03195862.1: 467-526 [+]
Database links

Mature sequence dno-miR-23a-5p

Accession MIMAT0047528
Sequence

1 - 

gggguuccuggggaugggauuu

 - 22

Get sequence
Evidence not experimental

Mature sequence dno-miR-23a-3p

Accession MIMAT0047529
Sequence

37 - 

aucacauugccagggauuuccaa

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).