Stem-loop sequence bta-mir-12064

AccessionMI0038497 (change log)
DescriptionBos taurus miR-12064 stem-loop
Stem-loop
   --ug       -u            aa 
5'     guaguau  ccuaguguggcg  u
       |||||||  ||||||||||||   
3'     caucgua  ggaucacaccgu  a
   ucaa       uu            ga 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 20557287-20557339 [+]
intergenic
Database links

Mature sequence bta-miR-12064

Accession MIMAT0046771
Sequence

1 - 

ugguaguauuccuaguguggc

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).