Stem-loop sequence bta-mir-12062

AccessionMI0038495 (change log)
DescriptionBos taurus miR-12062 stem-loop
Stem-loop
   --  u    u  u   gc        a a 
5'   ug cacg gg cca  cucagggu c u
     || |||| || |||  |||||||| |  
3'   ac gugu cc ggu  ggguccua g c
   uc  u    -  u   -a        c c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 1023039-1023094 [-]
intergenic
Database links

Mature sequence bta-miR-12062

Accession MIMAT0046769
Sequence

37 - 

ugggaugguccugugucacu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).