Stem-loop sequence bta-mir-12061

AccessionMI0038494 (change log)
DescriptionBos taurus miR-12061 stem-loop
Stem-loop
   --       aa a    ug    u 
5'   acgggac  a gucu  cagc g
     |||||||  | ||||  ||||  
3'   uguucug  u cagg  gucg g
   gg       gg c    gu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 76624308-76624355 [-]
intergenic
Database links

Mature sequence bta-miR-12061

Accession MIMAT0046768
Sequence

28 - 

ugugggaccugggucuugugg

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).