Stem-loop sequence bta-mir-12059

AccessionMI0038492 (change log)
DescriptionBos taurus miR-12059 stem-loop
Stem-loop
   --  aa    -a     -   u     augg g  gg       
5'   ga  cagg  gggag aga gcugg    g ca  uggaug 
     ||  ||||  ||||| ||| |||||    | ||  ||||| g
3'   cu  gucc  cccuc ucu cgacc    c gu  gccuga 
   uc  cc    ca     c   -     --aa g  ga       
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 20937478-20937557 [-]
intergenic
Database links

Mature sequence bta-miR-12059

Accession MIMAT0046766
Sequence

60 - 

ucuccucccacccugccuccu

 - 80

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).