Stem-loop sequence bta-mir-12056

AccessionMI0038489 (change log)
DescriptionBos taurus miR-12056 stem-loop
Stem-loop
   --        g  aug  ug   gggugucgggggguccugagg 
5'   uuuccuaa cc   uu  ggu                     g
     |||||||| ||   ||  |||                     c
3'   gaaggguu gg   gg  ccg                     u
   gg        g  gua  gu   accgacggucggagucggagg 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 99885648-99885736 [+]
intergenic
Database links

Mature sequence bta-miR-12056

Accession MIMAT0046763
Sequence

69 - 

cugggaugggguugggaaggg

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).