Stem-loop sequence bta-mir-12055

AccessionMI0038488 (change log)
DescriptionBos taurus miR-12055 stem-loop
Stem-loop
   --        -        a  a  uu c  a 
5'   uucuccuc gcccucgg ga cu  g cg c
     |||||||| |||||||| || ||  | ||  
3'   gagaggag ugggagcc cu ga  c gu c
   ug        g        -  c  cu a  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 97092798-97092859 [+]
intergenic
Database links

Mature sequence bta-miR-12055

Accession MIMAT0046762
Sequence

1 - 

uucuccucgcccucggagaacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).