Stem-loop sequence bta-mir-12053

AccessionMI0038486 (change log)
DescriptionBos taurus miR-12053 stem-loop
Stem-loop
   --      acau        ac   ugg 
5'   uguaga    guuuugga  ugc   c
     ||||||    ||||||||  |||   u
3'   acgucu    caggaccu  acg   u
   ag      ggau        au   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 116132081-116132137 [-]
intergenic
Database links

Mature sequence bta-miR-12053

Accession MIMAT0046760
Sequence

36 - 

uauccaggacuaggucugcaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).