Stem-loop sequence bta-mir-507b

AccessionMI0038470 (change log)
DescriptionBos taurus miR-507b stem-loop
Stem-loop
   --    uc           uc     gga 
5'   cacu  aggaagugcca  caugu   u
     ||||  |||||||||||  |||||    
3'   guga  uucuucauggu  guaua   a
   ag    ga           ua     aaa 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 29288071-29288128 [+]
intergenic
Database links

Mature sequence bta-miR-507b

Accession MIMAT0046744
Sequence

36 - 

ugauugguacuucuuagagugga

 - 58

Get sequence
Deep sequencing12 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).