Stem-loop sequence bta-mir-12045

AccessionMI0038469 (change log)
DescriptionBos taurus miR-12045 stem-loop
Stem-loop
   --a  c         -cu     u  aua   g 
5'    cc gggaagucc   gacac cg   uuu a
      || |||||||||   ||||| ||   ||| c
3'    gg cccuucagg   uugug gu   aaa g
   gga  u         aag     -  --g   a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 944425-944487 [-]
intergenic
Database links

Mature sequence bta-miR-12045

Accession MIMAT0046743
Sequence

1 - 

acccgggaagucccugacacu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).