Stem-loop sequence bta-mir-12044

AccessionMI0038468 (change log)
DescriptionBos taurus miR-12044 stem-loop
Stem-loop
   --         c        ----------g        
5'   aauggauua uucugauu           cugcuuu 
     ||||||||| ||||||||           |||||| g
3'   uuaccuaau aagacuaa           gaugaga 
   au         a        aagggauguua        
Get sequence
Deep sequencing
117 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 11331299-11331363 [-]
intergenic
Database links

Mature sequence bta-miR-12044

Accession MIMAT0046742
Sequence

1 - 

aauggauuacuucugauugcu

 - 21

Get sequence
Deep sequencing117 reads, 50 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).