Stem-loop sequence bta-mir-3065

AccessionMI0038467 (change log)
DescriptionBos taurus miR-3065 stem-loop
Stem-loop
   --       a   a   a      aguugc   ug 
5'   ucaacaa auc cug ugcugg      gug  u
     ||||||| ||| ||| ||||||      |||   
3'   gguuguu uag gac acgacu      cac  c
   gg       a   -   c      ------   ua 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 52407338-52407400 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-3065
bta-mir-3065chr19: 52407338-52407400 [-]
bta-mir-338chr19: 52407324-52407415 [+]
Database links

Mature sequence bta-miR-3065

Accession MIMAT0046741
Sequence

1 - 

ucaacaaaaucacugaugcugga

 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).