Stem-loop sequence bta-mir-12043

AccessionMI0038466 (change log)
DescriptionBos taurus miR-12043 stem-loop
Stem-loop
   --     a   g      uua   uag 
5'   accuc uag ccuggg   gug   a
     ||||| ||| ||||||   |||   g
3'   uggag auc ggaccu   cgc   u
   gg     g   g      --c   uac 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 88161712-88161764 [-]
intergenic
Database links

Mature sequence bta-miR-12043

Accession MIMAT0046740
Sequence

34 - 

ccuccagggcuaggaggugg

 - 53

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).