Stem-loop sequence bta-mir-12042

AccessionMI0038465 (change log)
DescriptionBos taurus miR-12042 stem-loop
Stem-loop
   --u     uu      u     u   gcaaa 
5'    guguc  uccuuc gugug gcu     u
      |||||  |||||| ||||| |||     g
3'    cacgg  aggagg cacac cga     a
   ugu     --      u     -   gauuc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 10475926-10475985 [-]
intergenic
Database links

Mature sequence bta-miR-12042

Accession MIMAT0046739
Sequence

1 - 

ugugucuuuccuucugugugugcu

 - 24

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).