Stem-loop sequence bta-mir-12041

AccessionMI0038463 (change log)
DescriptionBos taurus miR-12041 stem-loop
Stem-loop
   --acu      cu        u  au 
5'      gaaggc  ugcaccuc ga  g
        ||||||  |||||||| ||   
3'      uuuccg  acguggag cu  c
   ccucu      --        u  cu 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 24090530-24090579 [-]
intergenic
Database links

Mature sequence bta-miR-12041

Accession MIMAT0046737
Sequence

1 - 

acugaaggccuugcaccucugaau

 - 24

Get sequence
Deep sequencing12 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).