Stem-loop sequence bta-mir-12040

AccessionMI0038461 (change log)
DescriptionBos taurus miR-12040 stem-loop
Stem-loop
   --  c         g            - ua 
5'   ca augggcaac aauaauuuugua g  u
     || ||||||||| |||||||||||| |  u
3'   gu uacuuguug uuauuaaaacau c  u
   aa  c         g            g uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 23601773-23601834 [-]
intergenic
Database links

Mature sequence bta-miR-12040

Accession MIMAT0046735
Sequence

1 - 

cacaugggcaacgaauaauuuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).