Stem-loop sequence bta-mir-12039

AccessionMI0038460 (change log)
DescriptionBos taurus miR-12039 stem-loop
Stem-loop
   --u          cc       --   -  gg 
5'    ggagaggcua  gggcccu  gag cu  c
      ||||||||||  |||||||  ||| ||   
3'    cuucuucggu  cccggga  cuc gg  a
   ucu          --       cc   a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 110419184-110419242 [-]
intergenic
Database links

Mature sequence bta-miR-12039

Accession MIMAT0046734
Sequence

38 - 

ccagggcccuggcuucuucucu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).