Stem-loop sequence bta-mir-12038

AccessionMI0038459 (change log)
DescriptionBos taurus miR-12038 stem-loop
Stem-loop
   --a              uu       u  c 
5'    cauugacagcuucu  gcagagg ac u
      ||||||||||||||  ||||||| ||  
3'    gugacugucgaaga  cgucucc ug c
   ucc              --       c  g 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 58325807-58325864 [-]
intergenic
Database links

Mature sequence bta-miR-12038

Accession MIMAT0046733
Sequence

37 - 

ucugcagaagcugucagugccu

 - 58

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).